WHAT IS THE SIGNIFICANCE OF ALL THIS FOR NATURAL SELECTION?
As Richard Dawkins explains, natural selection is the differential survival of successful genes rather than alternative, less successful genes in gene pools. Natural selection doesn’t choose genes directly. It chooses their proxies: individual bodies. A gene can expect to find itself in the form of copies riding around inside a number of bodies simultaneously in a population of contemporaries and successively as generation gives way to generation. Therefore statistically a gene that tends, on average to have a good effect on the survival prospects of the bodies in which it finds itself will tend to increase in frequency in the gene pool.
DNA can replicate itself, and in this way, a single molecule of DNA can form two new molecules, each more or less identical to the parent molecule. It usually carries out this copying process with great accuracy so that species have great stability. However, it is not perfect. As DNA copies itself, it usually makes one error for every billion bits of genetic information: “the equivalent of a typist making one error in half a million pages”. This allows for the small variations necessary if evolution is to occur[1]. Individuals possessing bad mutations are more likely to die and less likely to reproduce, and this automatically removes the mutations from the gene pool. Natural selection favours the survival in the gene pool of the genetic mutations responsible for making crucial changes in embryos. The whole picture emerges as a consequence of hundreds of thousands of small, local interactions. The complications accumulated gradually over evolutionary time, each being accomplished by a small, subtle change in an existing local rule[2].
The code is invariant across all living organisms…
What needs to be emphasized is that the DNA code, the genetic code for each amino acid, is invariant across all living organisms, but the individual genes themselves vary. Not just the genetic code itself, but the whole gene/protein system for running life is the same in all animals, plants, fungi, bacteria, archaea and viruses. Thus, we have a close genetic similarity to chimpanzees, orangutans and monkeys and bear classification with them as primates. We bear a more distant genetic similarity to plants such as bananas. What varies is what is written in the code, not the code itself. And when we look comparatively at what is written in the code – the actual genetic sequences in all these different creatures – we find the same kind of hierarchical tree of resemblance[3].
For example, there is a gene called the Forkhead box protein P2 gene, a protein known for short as the FoxP2 gene that contributes to speech and language ability, acting not only in the brain but also on the nerves that control facial muscles. In humans, mutations of FoxP2 cause a severe speech and language disorder. The gene is shared by all mammals and many other creatures, and is a string of more than 2,000 letters. Set out below is a short stretch of 79 letters from somewhere in the middle of FoxP2 from letter number 831 to 910. The upper row is from a human, the middle row from a chimpanzee and the bottom row from a mouse.
CTCCAACACTTCCAAAGCATCACCACCAATAATCATCATTCCATAGTGAATGGACAGTCTTCAGTTCTAAGTGCAAGAC
CTCCACCACTTCCAAAGCGTCACCACCAATAATCATCATTCCATCGTGAATGGACAGTCTTCAGTTCTAAATGCAAGAC
CTCCACCACGTCCAAAGCATCACCACCCATCAACATCATTCCATAGTGAACGGACAGTCTTCAGTTCTGAAtGCAAGGC
One can tell that the FoxP2 is the same in all mammals because the great majority of code letters is the same, and that is true of the whole length of the gene, not just this stretch of 79 letters. Not quite all the chimpanzee letters are the same as ours, and somewhat fewer of the mouse ones are. The differences from the human are illustrated in red. Of the total of 2,076 letters in FoxP2, there are 9 in the case of the chimp, 139 in the case of the mouse, and that pattern holds for other genes as well, which explains why chimpanzees are very like us, while mice are less so[4].
This highlights another area where we have moved on since Darwin’s time and to our advantage: we now have a far better idea as to how inheritance works. Although sexually reproducing organisms inherit traits or genes from both parents, they inherit them in discrete packages, one from this parent and one from that. Genes don’t blend - they shuffle like a pack of cards, and they shuffle badly with groups of cards sticking together for several generations of shuffling before chance happens to split them, and whenever there is a systematic increase or decrease in the frequency with which we see a particular gene in a gene pool, we call that evolution[5].
[1] Christian, Maps of Time, 92.
[2] Dawkins, Greatest Show, Chapter 8, esp 248-250.
[3] Dawkins, Greatest Show, 315. Chimpanzees share about 98% of out DNA, Bananas about 50%, Fruit flies about 60%, and dogs about 75%. Identical twins have identical DNA: “Are humans impossible to ape?” SMH, 27 August 2009, where the similarities and differences between chimps and humans is explored.
[4] This example is drawn from Richard Dawkins, The Magic of Reality – How do we know what’s really true, Bantam Press, London 2011, 50-51. The FoxP2 gene is revisited in Richard Dawkins and Yan Wong's The Ancestor's Tale - A Pilgrimage to the Dawn of Life, Weidenfield and Nicolson, London 2004, 2nd edition 2016, where it is suggested that it may also have a role to play in brain, lung annd movement defects as well as speech: at 84-5.
[5] See also Christian, Maps of Time, 92
As Richard Dawkins explains, natural selection is the differential survival of successful genes rather than alternative, less successful genes in gene pools. Natural selection doesn’t choose genes directly. It chooses their proxies: individual bodies. A gene can expect to find itself in the form of copies riding around inside a number of bodies simultaneously in a population of contemporaries and successively as generation gives way to generation. Therefore statistically a gene that tends, on average to have a good effect on the survival prospects of the bodies in which it finds itself will tend to increase in frequency in the gene pool.
DNA can replicate itself, and in this way, a single molecule of DNA can form two new molecules, each more or less identical to the parent molecule. It usually carries out this copying process with great accuracy so that species have great stability. However, it is not perfect. As DNA copies itself, it usually makes one error for every billion bits of genetic information: “the equivalent of a typist making one error in half a million pages”. This allows for the small variations necessary if evolution is to occur[1]. Individuals possessing bad mutations are more likely to die and less likely to reproduce, and this automatically removes the mutations from the gene pool. Natural selection favours the survival in the gene pool of the genetic mutations responsible for making crucial changes in embryos. The whole picture emerges as a consequence of hundreds of thousands of small, local interactions. The complications accumulated gradually over evolutionary time, each being accomplished by a small, subtle change in an existing local rule[2].
The code is invariant across all living organisms…
What needs to be emphasized is that the DNA code, the genetic code for each amino acid, is invariant across all living organisms, but the individual genes themselves vary. Not just the genetic code itself, but the whole gene/protein system for running life is the same in all animals, plants, fungi, bacteria, archaea and viruses. Thus, we have a close genetic similarity to chimpanzees, orangutans and monkeys and bear classification with them as primates. We bear a more distant genetic similarity to plants such as bananas. What varies is what is written in the code, not the code itself. And when we look comparatively at what is written in the code – the actual genetic sequences in all these different creatures – we find the same kind of hierarchical tree of resemblance[3].
For example, there is a gene called the Forkhead box protein P2 gene, a protein known for short as the FoxP2 gene that contributes to speech and language ability, acting not only in the brain but also on the nerves that control facial muscles. In humans, mutations of FoxP2 cause a severe speech and language disorder. The gene is shared by all mammals and many other creatures, and is a string of more than 2,000 letters. Set out below is a short stretch of 79 letters from somewhere in the middle of FoxP2 from letter number 831 to 910. The upper row is from a human, the middle row from a chimpanzee and the bottom row from a mouse.
CTCCAACACTTCCAAAGCATCACCACCAATAATCATCATTCCATAGTGAATGGACAGTCTTCAGTTCTAAGTGCAAGAC
CTCCACCACTTCCAAAGCGTCACCACCAATAATCATCATTCCATCGTGAATGGACAGTCTTCAGTTCTAAATGCAAGAC
CTCCACCACGTCCAAAGCATCACCACCCATCAACATCATTCCATAGTGAACGGACAGTCTTCAGTTCTGAAtGCAAGGC
One can tell that the FoxP2 is the same in all mammals because the great majority of code letters is the same, and that is true of the whole length of the gene, not just this stretch of 79 letters. Not quite all the chimpanzee letters are the same as ours, and somewhat fewer of the mouse ones are. The differences from the human are illustrated in red. Of the total of 2,076 letters in FoxP2, there are 9 in the case of the chimp, 139 in the case of the mouse, and that pattern holds for other genes as well, which explains why chimpanzees are very like us, while mice are less so[4].
This highlights another area where we have moved on since Darwin’s time and to our advantage: we now have a far better idea as to how inheritance works. Although sexually reproducing organisms inherit traits or genes from both parents, they inherit them in discrete packages, one from this parent and one from that. Genes don’t blend - they shuffle like a pack of cards, and they shuffle badly with groups of cards sticking together for several generations of shuffling before chance happens to split them, and whenever there is a systematic increase or decrease in the frequency with which we see a particular gene in a gene pool, we call that evolution[5].
[1] Christian, Maps of Time, 92.
[2] Dawkins, Greatest Show, Chapter 8, esp 248-250.
[3] Dawkins, Greatest Show, 315. Chimpanzees share about 98% of out DNA, Bananas about 50%, Fruit flies about 60%, and dogs about 75%. Identical twins have identical DNA: “Are humans impossible to ape?” SMH, 27 August 2009, where the similarities and differences between chimps and humans is explored.
[4] This example is drawn from Richard Dawkins, The Magic of Reality – How do we know what’s really true, Bantam Press, London 2011, 50-51. The FoxP2 gene is revisited in Richard Dawkins and Yan Wong's The Ancestor's Tale - A Pilgrimage to the Dawn of Life, Weidenfield and Nicolson, London 2004, 2nd edition 2016, where it is suggested that it may also have a role to play in brain, lung annd movement defects as well as speech: at 84-5.
[5] See also Christian, Maps of Time, 92
The case of the rapidly multiplying and speedily diversifying cichlids
An example of the use of molecular processes in the context of natural selection has recently been identified in Africa’s Lake Victoria where what began as a single lineage belonging to the cichlid family of fishes has since given rise to a dazzling array of forms, and in so doing have out-finched Darwin’s finches, thereby providing a textbook example of what is known as an “adaptive radiation”[1].
An adaptive radiation is the phenomenon whereby one lineage spawns numerous species that evolve specialisations to an array of ecological roles, but the Lake Victoria cichlids far surpass Darwin’s finches in the astonishing speed with which they diversified. The more than 500 species that live there, and only there, today all evolved within the past 15,000 to 10,000 years – “an eyeblink in geologic terms”, as Axel Meyer, professor of zoology and evolutionary biology at the University of Konstanz in Germany has described it – compared with Darwin’s 14 finch species that evolved over several million years[2].
These cichlids display a huge variety of colours and range from about an inch to three feet in length, and they have evolved adaptations to eating every conceivable foot source in their environment. Thus, algae scrapers have flat teeth like human incisors that allow them to nibble the nutritious growths on rock surfaces; insect eaters have long, pointy teeth that help them to get into rock crevices; ambush predators possess huge extendable jaws with which they can suck in their unsuspecting prey in a matter of milliseconds. And even these degrees of specialty encapsulate a wide variety of sub-specialties. Among the algae scrapers, for example, some species are adapted to foraging in the wave-break zone, others to harvesting food from one particular pile of rocks and no other, and still others to feeding on certain angles from the rocks or only on specific types of algae.
And some highly specialised traits have evolved repeatedly. Some species feed on the scales of other fishes almost exclusively, and in so doing have evolved rakelike teeth that allow them to hold onto the scales of their victims. Furthermore, their jaws have evolved symmetrically, opening either to the right or the left, but not both so as to better grab the scales from a given side of their target. Others have evolved thick lips that enable them to target and suck out prey found in rock crevices. In still others, distinct colouration patterns have emerged which help to obscure their body shapes from watchful prey. And yet others again have evolved a second set of jaws in the throat, both sets giving them some insurance in masticating different food sources in case one particular food source dries up.
Again, the question is, how did all this occur? Today, researchers such as Meyer have been able to decode the sequence of DNA code letters in a variety of cichlid genome species, and in so doing have been able to identify certain features of their genomes that help to explain the group’s diversity[3]. In different varieties, they have found:
Meyer’s researchers have hypothesised that new random mutations such as those seen in the non-coding elements in the genome and those that give rise to microRNAs have featured significantly in the extraordinary evolution of these fishes, but the suspicion is that relatively old genetic variation, including that from the duplicated and jumping genes may have done most of the work, thereby enabling them to take advantage of new ecological opportunities, such as those that arose when ancestral river-dwelling cichlids colonized the Great Lakes of Africa, suddenly rendering them advantageous.
The old genetic material is significant in this process, because the gene pool of a species still retains old gene variants even after fish have branched off from their ancestors to form a new species. So not only does a young species retain old DNA from its ancestors, it may still be similar enough to interbreed and hybridise with closely related species. Such mixing would allow new gene variants to flow across species boundaries, in the process creating more potentially useful genetic material that can be recycled when needed. Environmental factors in the form of the more complex habitats and thus more ecological niches in the Great Lakes have also had a role to play as the cichlids evolved feeding specialisations to fill these niches and further diversification took place as skin colour differences arose and females developed preferences for particular hues. Meyer concludes that the research into the cichlid genome in the context of the stunning speed of the fishes’ speciation may succeed in ultimately providing not only a greater understanding of the language of the genome itself, but also “the DNA that connects all living things even as it drives them apart”[4]. As Darwin himself said “It is not the strongest of the species that survives nor the most intelligent. It is the one that is most adaptable to change”.
[1] See Axel Meyer, “Extreme Evolution”, Scientific American, April 2015, pp 56-61.
[2] Ibid, at 58.
[3] Ibid, pp 59-61.
[4] Meyer, ibid, at 61.
Sources for links at top of page: Left: en.wikipedia.org Right: answersingenesis.org
An example of the use of molecular processes in the context of natural selection has recently been identified in Africa’s Lake Victoria where what began as a single lineage belonging to the cichlid family of fishes has since given rise to a dazzling array of forms, and in so doing have out-finched Darwin’s finches, thereby providing a textbook example of what is known as an “adaptive radiation”[1].
An adaptive radiation is the phenomenon whereby one lineage spawns numerous species that evolve specialisations to an array of ecological roles, but the Lake Victoria cichlids far surpass Darwin’s finches in the astonishing speed with which they diversified. The more than 500 species that live there, and only there, today all evolved within the past 15,000 to 10,000 years – “an eyeblink in geologic terms”, as Axel Meyer, professor of zoology and evolutionary biology at the University of Konstanz in Germany has described it – compared with Darwin’s 14 finch species that evolved over several million years[2].
These cichlids display a huge variety of colours and range from about an inch to three feet in length, and they have evolved adaptations to eating every conceivable foot source in their environment. Thus, algae scrapers have flat teeth like human incisors that allow them to nibble the nutritious growths on rock surfaces; insect eaters have long, pointy teeth that help them to get into rock crevices; ambush predators possess huge extendable jaws with which they can suck in their unsuspecting prey in a matter of milliseconds. And even these degrees of specialty encapsulate a wide variety of sub-specialties. Among the algae scrapers, for example, some species are adapted to foraging in the wave-break zone, others to harvesting food from one particular pile of rocks and no other, and still others to feeding on certain angles from the rocks or only on specific types of algae.
And some highly specialised traits have evolved repeatedly. Some species feed on the scales of other fishes almost exclusively, and in so doing have evolved rakelike teeth that allow them to hold onto the scales of their victims. Furthermore, their jaws have evolved symmetrically, opening either to the right or the left, but not both so as to better grab the scales from a given side of their target. Others have evolved thick lips that enable them to target and suck out prey found in rock crevices. In still others, distinct colouration patterns have emerged which help to obscure their body shapes from watchful prey. And yet others again have evolved a second set of jaws in the throat, both sets giving them some insurance in masticating different food sources in case one particular food source dries up.
Again, the question is, how did all this occur? Today, researchers such as Meyer have been able to decode the sequence of DNA code letters in a variety of cichlid genome species, and in so doing have been able to identify certain features of their genomes that help to explain the group’s diversity[3]. In different varieties, they have found:
- abundant mutations that have produced changes in the amino acids resulting in an overabundance of proteins, suggesting the genes were under intense pressure to evolve quickly.
- a high rate of gene duplication in which errors in DNA replication produce mutations in the form of multiple copies of genes. The extra copies can change in function without harming the fishes (they still have the original which still works to rely upon) and thus help them to adapt to their environment.
- transposable or jumping genes – sequences of DNA that make copies of themselves and jump to new positions in the genome. Depending on where the jumping gene lands, it may change the function of a nearby protein-encoding gene. Cichlids underwent several periods in which jumping genes accrued rapidly, possibly hastening evolution.
- mutations in non-coding areas of DNA that in evolution are typically highly conserved and unchanging, probably because they affect gene function. Cichlids have significantly more mutations in some of these regions than anticipated, exhibiting a pattern that suggests the associated genes experienced a shift in function.
- the conservation of small pieces of genetic material called microRNAs which can block genes from doing their job of making proteins. Cichlids have more new microRNAs than other fishes have. With their ability to control genes in particular tissues, these microRNAs may have enabled the precise sculpting that gave rise to cichlid feeding specialisation.
Meyer’s researchers have hypothesised that new random mutations such as those seen in the non-coding elements in the genome and those that give rise to microRNAs have featured significantly in the extraordinary evolution of these fishes, but the suspicion is that relatively old genetic variation, including that from the duplicated and jumping genes may have done most of the work, thereby enabling them to take advantage of new ecological opportunities, such as those that arose when ancestral river-dwelling cichlids colonized the Great Lakes of Africa, suddenly rendering them advantageous.
The old genetic material is significant in this process, because the gene pool of a species still retains old gene variants even after fish have branched off from their ancestors to form a new species. So not only does a young species retain old DNA from its ancestors, it may still be similar enough to interbreed and hybridise with closely related species. Such mixing would allow new gene variants to flow across species boundaries, in the process creating more potentially useful genetic material that can be recycled when needed. Environmental factors in the form of the more complex habitats and thus more ecological niches in the Great Lakes have also had a role to play as the cichlids evolved feeding specialisations to fill these niches and further diversification took place as skin colour differences arose and females developed preferences for particular hues. Meyer concludes that the research into the cichlid genome in the context of the stunning speed of the fishes’ speciation may succeed in ultimately providing not only a greater understanding of the language of the genome itself, but also “the DNA that connects all living things even as it drives them apart”[4]. As Darwin himself said “It is not the strongest of the species that survives nor the most intelligent. It is the one that is most adaptable to change”.
[1] See Axel Meyer, “Extreme Evolution”, Scientific American, April 2015, pp 56-61.
[2] Ibid, at 58.
[3] Ibid, pp 59-61.
[4] Meyer, ibid, at 61.
Sources for links at top of page: Left: en.wikipedia.org Right: answersingenesis.org